WebMay 16, 2024 · HABA is displaced when biotin binds to the Alexa Fluor 488 dye-labeled avidin, resulting in decreased FRET efficiency. This mechanism results in an increase in fluorescence intensity directly related to the amount of biotin present in the sample. The assay is able to detect as little as 4 pmol biotin in a 0.1 mL volume within 15 min of … WebFeb 21, 2024 · The short fluorescent ssDNA substrate used in FCS experiments was prepared with synthetic oligonucleotides (Eurogentec) labeled either with Biotin or Alexa-488 in 5’ in order to generate a Biotin-labeled DNA strand and a fluorescently-labeled DNA strand (Sequence : Biotin-5’GCTTGCATGCCTGCAGGTCG3’; Alexa488 …
Fawn Creek Township, KS - Niche
WebBiotin. Digoxin. Fluorescein. His Tag. Horseradish Peroxidase. Antibody Description: Unconjugated Horseradish Peroxidase Alkaline Phosphatase Biotin-SP (long ... Alexa Fluor® 488 A=493, E=519 Fluorescein (FITC) A=492, E=520 ... WebCaptAvidin Biotin-Binding Proteins and Affinity Matrices The high affinity of avidin for biotin was first exploited in histochemical applications ... Oregon Green 488 (496/524) S-6368 A-6374 FluoSpheres (505/515) F-8780 F-8771 Oregon Green 514 (511/530) S-6369 Alexa Fluor 532 (530/554) S-11224 chipboard facts
Fluorescent biotin Sigma-Aldrich
WebAlexa fluor 488 labeled PEG Biotin (AF488 PEG Biotin is a green fluorescent PE biotin derivative having excitation/emission wavelength around 495 nm/520 nm. Alexa fluor 488 … WebFeb 2, 2024 · Beltone is a leading global hearing aid brand with a strong retail presence in North America through 1,500 hearing care centers. Founded in 1940 and based in … WebAPDye™ 488 Biotin can be used for detecting and quantifying biotin binding sites of avidin, streptavidin or neutravidin. This reagent overcomes major shortcomings of commonly used Biotin-4-fluorescein – poor … chipboard edging